Review



pard3 probes  (Biosearch Technologies Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Biosearch Technologies Inc pard3 probes
    Pard3 Probes, supplied by Biosearch Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pard3+probes/pard3+probes/pmc09017151__mmc5-297-28-29
    Average 90 stars, based on 1 article reviews
    pard3 probes - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Modification:

    Article Title: Interrogating RNA and protein spatial subcellular distribution in smFISH data with DypFISH
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER tRNA from E. coli MRE 600 Sigma # TRNAMRE-RO Formamide Sigma # F9037-100ML BSA Thermo Fisher Scientific # AM2616 D-(+)-Glucose solution Sigma # 50-99-7 Glucose oxidase Sigma # 9001-37-0 Catalase Sigma # 9001-05-2 DAPI Life Technologies # D1306 Critical commercial assays DharmaFECT one reagent Dharmacon, GE Healthcare # T-2005-01 RNeasy Mini Kit (Qiagen) Qiagen # 74104 Superscript IV First-Strand Synthesis System Invitrogen # 8091050 Experimental models: Cell lines NIH/3T3 ATCC, Cellonex # CCL-92 Human umbilical vein endothelial cells (HUVECs) Lonza # C2519A Experimental models: Organisms/strains Mouse: C57BL/6 Strain Charles River code: 027 Oligonucleotides ON-TARGETplus Human PRRC2C (23215) siRNA - SMARTpool, 10 nmol Dharmacon # L-014078-00-0010 On-Targetplus Non-targeting siRNA #1, 20 nM Dharmacon # D-001810-01-05 human GAPDH forward sequence GTCAAGGCTGAGAACGGGAA This manuscript N/A human GAPDH reverse sequence TGGACTCCACGACGTACTCA This manuscript N/A human PRRC2C forward sequence GAAGCAGTTCCAGTCAGCC This manuscript N/A human PRRC2C reverse sequence GTTGCGTGGACTGAAGAACC This manuscript N/A Gapdh probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Arhgdia probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A b-Actin probes - 24-48 20-mers, each 20- mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Rab13 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A (Continued on next page) Cell Reports Methods 1, 100068, September 27, 2021 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pkp4 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Pard3 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Deposited data HDF5 data files of primary and secondary image descriptors for FISH Micropatterned images, CHX, CytoD, Nocodazole, PRRC2C and Muscle data http://dypfish.org/ https://doi.org/10.5281/zenodo.5155127 Software and algorithms Chemotaxis and Migration Tool Chemotaxis and Migration Tool (https:// ibidi.com/chemotaxis-analysis/ 171-chemotaxis-and-migration-tool.html) N/A FiJi/ImageJ (2.0.0) Schindelin et al., 2012 N/A GraphPad Prism GraphPad Prism (https://graphpad.com) N/A MATLAB - polarity analysis script to calculate the Polarity Index (PI) Carvalho et al., 2019 N/A ICY and mManager de Chaumont et al., 2012 https://icy.bioimageanalysis.org Edelstein et al., 2014 https://doi.org/10.14440/jbm.2014.36 N/A SV Control software Optical Biosystems N/A HDF5 The HDF Group, Hierarchical data format version 5, 2000-2010, http://www. hdfgroup.org/HDF5 N/A DypFISH code https://github.com/cbib/dypfish https://doi.org/10.5281/zenodo.5153514 Article ll OPEN ACCESS ..

    Fluorescence In Situ Hybridization:

    Article Title: Interrogating RNA and protein spatial subcellular distribution in smFISH data with DypFISH
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER tRNA from E. coli MRE 600 Sigma # TRNAMRE-RO Formamide Sigma # F9037-100ML BSA Thermo Fisher Scientific # AM2616 D-(+)-Glucose solution Sigma # 50-99-7 Glucose oxidase Sigma # 9001-37-0 Catalase Sigma # 9001-05-2 DAPI Life Technologies # D1306 Critical commercial assays DharmaFECT one reagent Dharmacon, GE Healthcare # T-2005-01 RNeasy Mini Kit (Qiagen) Qiagen # 74104 Superscript IV First-Strand Synthesis System Invitrogen # 8091050 Experimental models: Cell lines NIH/3T3 ATCC, Cellonex # CCL-92 Human umbilical vein endothelial cells (HUVECs) Lonza # C2519A Experimental models: Organisms/strains Mouse: C57BL/6 Strain Charles River code: 027 Oligonucleotides ON-TARGETplus Human PRRC2C (23215) siRNA - SMARTpool, 10 nmol Dharmacon # L-014078-00-0010 On-Targetplus Non-targeting siRNA #1, 20 nM Dharmacon # D-001810-01-05 human GAPDH forward sequence GTCAAGGCTGAGAACGGGAA This manuscript N/A human GAPDH reverse sequence TGGACTCCACGACGTACTCA This manuscript N/A human PRRC2C forward sequence GAAGCAGTTCCAGTCAGCC This manuscript N/A human PRRC2C reverse sequence GTTGCGTGGACTGAAGAACC This manuscript N/A Gapdh probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Arhgdia probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A b-Actin probes - 24-48 20-mers, each 20- mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Rab13 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A (Continued on next page) Cell Reports Methods 1, 100068, September 27, 2021 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pkp4 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Pard3 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Deposited data HDF5 data files of primary and secondary image descriptors for FISH Micropatterned images, CHX, CytoD, Nocodazole, PRRC2C and Muscle data http://dypfish.org/ https://doi.org/10.5281/zenodo.5155127 Software and algorithms Chemotaxis and Migration Tool Chemotaxis and Migration Tool (https:// ibidi.com/chemotaxis-analysis/ 171-chemotaxis-and-migration-tool.html) N/A FiJi/ImageJ (2.0.0) Schindelin et al., 2012 N/A GraphPad Prism GraphPad Prism (https://graphpad.com) N/A MATLAB - polarity analysis script to calculate the Polarity Index (PI) Carvalho et al., 2019 N/A ICY and mManager de Chaumont et al., 2012 https://icy.bioimageanalysis.org Edelstein et al., 2014 https://doi.org/10.14440/jbm.2014.36 N/A SV Control software Optical Biosystems N/A HDF5 The HDF Group, Hierarchical data format version 5, 2000-2010, http://www. hdfgroup.org/HDF5 N/A DypFISH code https://github.com/cbib/dypfish https://doi.org/10.5281/zenodo.5153514 Article ll OPEN ACCESS ..

    Software:

    Article Title: Interrogating RNA and protein spatial subcellular distribution in smFISH data with DypFISH
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER tRNA from E. coli MRE 600 Sigma # TRNAMRE-RO Formamide Sigma # F9037-100ML BSA Thermo Fisher Scientific # AM2616 D-(+)-Glucose solution Sigma # 50-99-7 Glucose oxidase Sigma # 9001-37-0 Catalase Sigma # 9001-05-2 DAPI Life Technologies # D1306 Critical commercial assays DharmaFECT one reagent Dharmacon, GE Healthcare # T-2005-01 RNeasy Mini Kit (Qiagen) Qiagen # 74104 Superscript IV First-Strand Synthesis System Invitrogen # 8091050 Experimental models: Cell lines NIH/3T3 ATCC, Cellonex # CCL-92 Human umbilical vein endothelial cells (HUVECs) Lonza # C2519A Experimental models: Organisms/strains Mouse: C57BL/6 Strain Charles River code: 027 Oligonucleotides ON-TARGETplus Human PRRC2C (23215) siRNA - SMARTpool, 10 nmol Dharmacon # L-014078-00-0010 On-Targetplus Non-targeting siRNA #1, 20 nM Dharmacon # D-001810-01-05 human GAPDH forward sequence GTCAAGGCTGAGAACGGGAA This manuscript N/A human GAPDH reverse sequence TGGACTCCACGACGTACTCA This manuscript N/A human PRRC2C forward sequence GAAGCAGTTCCAGTCAGCC This manuscript N/A human PRRC2C reverse sequence GTTGCGTGGACTGAAGAACC This manuscript N/A Gapdh probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Arhgdia probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A b-Actin probes - 24-48 20-mers, each 20- mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Rab13 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A (Continued on next page) Cell Reports Methods 1, 100068, September 27, 2021 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pkp4 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Pard3 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Deposited data HDF5 data files of primary and secondary image descriptors for FISH Micropatterned images, CHX, CytoD, Nocodazole, PRRC2C and Muscle data http://dypfish.org/ https://doi.org/10.5281/zenodo.5155127 Software and algorithms Chemotaxis and Migration Tool Chemotaxis and Migration Tool (https:// ibidi.com/chemotaxis-analysis/ 171-chemotaxis-and-migration-tool.html) N/A FiJi/ImageJ (2.0.0) Schindelin et al., 2012 N/A GraphPad Prism GraphPad Prism (https://graphpad.com) N/A MATLAB - polarity analysis script to calculate the Polarity Index (PI) Carvalho et al., 2019 N/A ICY and mManager de Chaumont et al., 2012 https://icy.bioimageanalysis.org Edelstein et al., 2014 https://doi.org/10.14440/jbm.2014.36 N/A SV Control software Optical Biosystems N/A HDF5 The HDF Group, Hierarchical data format version 5, 2000-2010, http://www. hdfgroup.org/HDF5 N/A DypFISH code https://github.com/cbib/dypfish https://doi.org/10.5281/zenodo.5153514 Article ll OPEN ACCESS ..

    Chemotaxis Assay:

    Article Title: Interrogating RNA and protein spatial subcellular distribution in smFISH data with DypFISH
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER tRNA from E. coli MRE 600 Sigma # TRNAMRE-RO Formamide Sigma # F9037-100ML BSA Thermo Fisher Scientific # AM2616 D-(+)-Glucose solution Sigma # 50-99-7 Glucose oxidase Sigma # 9001-37-0 Catalase Sigma # 9001-05-2 DAPI Life Technologies # D1306 Critical commercial assays DharmaFECT one reagent Dharmacon, GE Healthcare # T-2005-01 RNeasy Mini Kit (Qiagen) Qiagen # 74104 Superscript IV First-Strand Synthesis System Invitrogen # 8091050 Experimental models: Cell lines NIH/3T3 ATCC, Cellonex # CCL-92 Human umbilical vein endothelial cells (HUVECs) Lonza # C2519A Experimental models: Organisms/strains Mouse: C57BL/6 Strain Charles River code: 027 Oligonucleotides ON-TARGETplus Human PRRC2C (23215) siRNA - SMARTpool, 10 nmol Dharmacon # L-014078-00-0010 On-Targetplus Non-targeting siRNA #1, 20 nM Dharmacon # D-001810-01-05 human GAPDH forward sequence GTCAAGGCTGAGAACGGGAA This manuscript N/A human GAPDH reverse sequence TGGACTCCACGACGTACTCA This manuscript N/A human PRRC2C forward sequence GAAGCAGTTCCAGTCAGCC This manuscript N/A human PRRC2C reverse sequence GTTGCGTGGACTGAAGAACC This manuscript N/A Gapdh probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Arhgdia probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A b-Actin probes - 24-48 20-mers, each 20- mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Rab13 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A (Continued on next page) Cell Reports Methods 1, 100068, September 27, 2021 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pkp4 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Pard3 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Deposited data HDF5 data files of primary and secondary image descriptors for FISH Micropatterned images, CHX, CytoD, Nocodazole, PRRC2C and Muscle data http://dypfish.org/ https://doi.org/10.5281/zenodo.5155127 Software and algorithms Chemotaxis and Migration Tool Chemotaxis and Migration Tool (https:// ibidi.com/chemotaxis-analysis/ 171-chemotaxis-and-migration-tool.html) N/A FiJi/ImageJ (2.0.0) Schindelin et al., 2012 N/A GraphPad Prism GraphPad Prism (https://graphpad.com) N/A MATLAB - polarity analysis script to calculate the Polarity Index (PI) Carvalho et al., 2019 N/A ICY and mManager de Chaumont et al., 2012 https://icy.bioimageanalysis.org Edelstein et al., 2014 https://doi.org/10.14440/jbm.2014.36 N/A SV Control software Optical Biosystems N/A HDF5 The HDF Group, Hierarchical data format version 5, 2000-2010, http://www. hdfgroup.org/HDF5 N/A DypFISH code https://github.com/cbib/dypfish https://doi.org/10.5281/zenodo.5153514 Article ll OPEN ACCESS ..

    Migration:

    Article Title: Interrogating RNA and protein spatial subcellular distribution in smFISH data with DypFISH
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER tRNA from E. coli MRE 600 Sigma # TRNAMRE-RO Formamide Sigma # F9037-100ML BSA Thermo Fisher Scientific # AM2616 D-(+)-Glucose solution Sigma # 50-99-7 Glucose oxidase Sigma # 9001-37-0 Catalase Sigma # 9001-05-2 DAPI Life Technologies # D1306 Critical commercial assays DharmaFECT one reagent Dharmacon, GE Healthcare # T-2005-01 RNeasy Mini Kit (Qiagen) Qiagen # 74104 Superscript IV First-Strand Synthesis System Invitrogen # 8091050 Experimental models: Cell lines NIH/3T3 ATCC, Cellonex # CCL-92 Human umbilical vein endothelial cells (HUVECs) Lonza # C2519A Experimental models: Organisms/strains Mouse: C57BL/6 Strain Charles River code: 027 Oligonucleotides ON-TARGETplus Human PRRC2C (23215) siRNA - SMARTpool, 10 nmol Dharmacon # L-014078-00-0010 On-Targetplus Non-targeting siRNA #1, 20 nM Dharmacon # D-001810-01-05 human GAPDH forward sequence GTCAAGGCTGAGAACGGGAA This manuscript N/A human GAPDH reverse sequence TGGACTCCACGACGTACTCA This manuscript N/A human PRRC2C forward sequence GAAGCAGTTCCAGTCAGCC This manuscript N/A human PRRC2C reverse sequence GTTGCGTGGACTGAAGAACC This manuscript N/A Gapdh probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Arhgdia probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A b-Actin probes - 24-48 20-mers, each 20- mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Rab13 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A (Continued on next page) Cell Reports Methods 1, 100068, September 27, 2021 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pkp4 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Pard3 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Deposited data HDF5 data files of primary and secondary image descriptors for FISH Micropatterned images, CHX, CytoD, Nocodazole, PRRC2C and Muscle data http://dypfish.org/ https://doi.org/10.5281/zenodo.5155127 Software and algorithms Chemotaxis and Migration Tool Chemotaxis and Migration Tool (https:// ibidi.com/chemotaxis-analysis/ 171-chemotaxis-and-migration-tool.html) N/A FiJi/ImageJ (2.0.0) Schindelin et al., 2012 N/A GraphPad Prism GraphPad Prism (https://graphpad.com) N/A MATLAB - polarity analysis script to calculate the Polarity Index (PI) Carvalho et al., 2019 N/A ICY and mManager de Chaumont et al., 2012 https://icy.bioimageanalysis.org Edelstein et al., 2014 https://doi.org/10.14440/jbm.2014.36 N/A SV Control software Optical Biosystems N/A HDF5 The HDF Group, Hierarchical data format version 5, 2000-2010, http://www. hdfgroup.org/HDF5 N/A DypFISH code https://github.com/cbib/dypfish https://doi.org/10.5281/zenodo.5153514 Article ll OPEN ACCESS ..

    Control:

    Article Title: Interrogating RNA and protein spatial subcellular distribution in smFISH data with DypFISH
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER tRNA from E. coli MRE 600 Sigma # TRNAMRE-RO Formamide Sigma # F9037-100ML BSA Thermo Fisher Scientific # AM2616 D-(+)-Glucose solution Sigma # 50-99-7 Glucose oxidase Sigma # 9001-37-0 Catalase Sigma # 9001-05-2 DAPI Life Technologies # D1306 Critical commercial assays DharmaFECT one reagent Dharmacon, GE Healthcare # T-2005-01 RNeasy Mini Kit (Qiagen) Qiagen # 74104 Superscript IV First-Strand Synthesis System Invitrogen # 8091050 Experimental models: Cell lines NIH/3T3 ATCC, Cellonex # CCL-92 Human umbilical vein endothelial cells (HUVECs) Lonza # C2519A Experimental models: Organisms/strains Mouse: C57BL/6 Strain Charles River code: 027 Oligonucleotides ON-TARGETplus Human PRRC2C (23215) siRNA - SMARTpool, 10 nmol Dharmacon # L-014078-00-0010 On-Targetplus Non-targeting siRNA #1, 20 nM Dharmacon # D-001810-01-05 human GAPDH forward sequence GTCAAGGCTGAGAACGGGAA This manuscript N/A human GAPDH reverse sequence TGGACTCCACGACGTACTCA This manuscript N/A human PRRC2C forward sequence GAAGCAGTTCCAGTCAGCC This manuscript N/A human PRRC2C reverse sequence GTTGCGTGGACTGAAGAACC This manuscript N/A Gapdh probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Arhgdia probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A b-Actin probes - 24-48 20-mers, each 20- mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Rab13 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A (Continued on next page) Cell Reports Methods 1, 100068, September 27, 2021 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Pkp4 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Pard3 probes - 24-48 20-mers, each 20-mer containing a mdC(TEG-Amino) 3’ modification used to conjugate an NHSester ATTO-565 fluorescent dye (ATTOTEC) to the probe Biosearch Technologies N/A Deposited data HDF5 data files of primary and secondary image descriptors for FISH Micropatterned images, CHX, CytoD, Nocodazole, PRRC2C and Muscle data http://dypfish.org/ https://doi.org/10.5281/zenodo.5155127 Software and algorithms Chemotaxis and Migration Tool Chemotaxis and Migration Tool (https:// ibidi.com/chemotaxis-analysis/ 171-chemotaxis-and-migration-tool.html) N/A FiJi/ImageJ (2.0.0) Schindelin et al., 2012 N/A GraphPad Prism GraphPad Prism (https://graphpad.com) N/A MATLAB - polarity analysis script to calculate the Polarity Index (PI) Carvalho et al., 2019 N/A ICY and mManager de Chaumont et al., 2012 https://icy.bioimageanalysis.org Edelstein et al., 2014 https://doi.org/10.14440/jbm.2014.36 N/A SV Control software Optical Biosystems N/A HDF5 The HDF Group, Hierarchical data format version 5, 2000-2010, http://www. hdfgroup.org/HDF5 N/A DypFISH code https://github.com/cbib/dypfish https://doi.org/10.5281/zenodo.5153514 Article ll OPEN ACCESS ..



    Similar Products

    taqman probe pard3  (Thermo Fisher)
    90
    Thermo Fisher taqman probe pard3

    Taqman Probe Pard3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pard3+probes/shrna+constructs/pmc07572125-22-3-7
    Average 90 stars, based on 1 article reviews
    taqman probe pard3 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    pard3 probes  (Biosearch Technologies Inc)
    90
    Biosearch Technologies Inc pard3 probes

    Pard3 Probes, supplied by Biosearch Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pard3+probes/pard3+probes/pmc09017151__mmc5-297-28-29
    Average 90 stars, based on 1 article reviews
    pard3 probes - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    salsa p448-a1-lot0811 pard3 probe mix  (MRC-Holland)
    90
    MRC-Holland salsa p448-a1-lot0811 pard3 probe mix

    Salsa P448 A1 Lot0811 Pard3 Probe Mix, supplied by MRC-Holland, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pard3+probes/salsa+p448+a1+lot0811+pard3+probe+mix/pmc04612637-36-7-15
    Average 90 stars, based on 1 article reviews
    salsa p448-a1-lot0811 pard3 probe mix - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: eLife

    Article Title: Replication Study: Coding-independent regulation of the tumor suppressor PTEN by competing endogenous mRNAs

    doi: 10.7554/eLife.56651

    Figure Lengend Snippet:

    Article Snippet: Sequence-based reagent , TaqMan probe PARD3 , Thermo Fisher Scientific , Hs00969077_m1 , .

    Techniques: Recombinant, Plasmid Preparation, Sequencing, Software, Real-time Polymerase Chain Reaction